Nevertheless, the heterologous aromatic side chains at the P2 anchor motif resulted in the reduction of the binding affinity of variant peptides to H-2Kd molecules (Fig. 1c and Supplementary material,

Fig. S3). The structural similarity of side chains is required for anchor motifs to dock peptide epitopes into the pocket of MHC class I molecules. The peptide–MHC binding interface is more tolerant of the subtle change of the functional group at the anchor motif of natural amino acids, such as phenylalanine (F) replacing tyrosine (Y). The binding capacity of peptides to MHC class I molecules had become the most important consideration for the epitope prediction of immunoinformatical programmes. FDA approved Drug Library clinical trial Most servers developed for the prediction of epitopes were based on peptide–MHC binding affinity.27–30,32 As in much of the documented research

into peptide–MHC class I binding experiments, we have mapped CD8 T-lymphocyte variant selleck screening library epitopes without obvious anchor motifs of primary amino acid sequences, which were still recognised by virus-specific CD8 T lymphocytes (Fig. 1c and 2). Anchor motifs and peptide–MHC binding affinity are not sufficient to predict all the protective epitopes from viral antigens22,45,46 (Fig. 2). T-cell receptor binding of expressed specific peptide–MHC class I complexes on the surfaces of infected cells is less understood in the field of T-lymphocyte recognition.26,31,55 We have found that the efficient binding of peptides to MHC class I molecules does not always ensure the recognition of peptide–MHC class I complexes by either virus-specific or peptide-specific CD8 T lymphocytes (Figs. 1, 2 and 3). Peptide–MHC class I binding and TCR recognition are actually two distinct antigen presentation events given that variant peptides with amino acid substitutions at the TCR contact site obscure the recognition of specific CD8 T lymphocytes without Palmatine compromising their binding capacity to MHC class I molecules even in the presence of analogous side chains of natural amino acids (Figs 1c, 2a and 3b). Parallel to two distinct antigen presentation

events: peptide-MHC class I binding and TCR recognition, physiochemical distributions of amino acids from MHC class I-restricted epitopes represent two separated interfaces of discrete physiochemical characteristics. Conserved and hydrophobic amino acids are identified at P2 and P9 anchor motifs on the peptide-H-2Kd interface (Supplementary material, Fig. S4a), whereas the peptide–TCR interface expresses variable amino acid distributions in terms of hydropathy and isoelectric indexes (Supplementary material, Fig. S4). Extensive data from X-ray diffraction crystal structures of different alleles of MHC–peptide–TCR complexes provides detailed binding and recognition information of interfaces among peptide, MHC and TCR.

3) were constructed LBH589 manufacturer by PCR-based amplification and subcloned into the pcDNA3 eukaryotic expression vector (Invitrogen, Carlsbad, CA, USA). The primers were as followed: Klf10-pcDNA3: GAATTCGCAGCCAGGCAGCTCGCGAC, GCGGCCGCTCACTGTGCGGAAGCAGGGGT Klf11-pcDNA3: GAATTCCTCCTGCCTCGCAGCATTGCT,

GCGGCCGCTCAGCCAGAGGCCGGCAAGG Bone marrow cells were isolated from the tibia and femur and cultured in RPMI 1640 medium with 10% FBS (Hyclone, UT, USA), 2 mM glutamine, 100 units/mL penicillin-streptomycin, 10 ng/mL M-CSF (PeproTech, NJ, USA), or 20 ng/mL murine selleck chemicals GM-CSF (R&D systems, MN, USA) at 37°C with 5% CO2 for 5 days to harvest M-BMMs or GM-BMMs, respectively. HEK293 cells were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in DMEM supplemented with 2 mM glutamine, 100 units/mL penicillin and streptomycin, and 10% FBS at 37°C in the presence of 5% CO2.

Transient transfection into primary mouse bone marrow derived macrophage using Amaxa Mouse Macrophage Nucleofection kit (Cat. No. VPA-1009) was performed according to manufacturer’s instruction. Transient transfection into HEK293 cells was performed by Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instruction. To knock down Klf11 in M-BMMs from WT or klf10-deficient mouse, the ON-TARGET plus SMART Cyclin-dependent kinase 3 pool mouse-TIEG3 (194655) or the negative control siRNA (Thermo Scientific Dharmacon, Lafayette, CO, USA) were transfected into M-BMMs using INTERFERinTM (Polyplus, Graffenstaden, France) according to the manufacturer’s instruction. Another siRNA

against Klf11 (5′- UGCAUGUGGACCUUUCGCUGUCAUG-3′) and control siRNA were synthesized by Shanghai GenePharma Co., Ltd. and were transfected using INTERFERinTM (Polyplus, Graffenstaden, France) according to the manufacturer’s instruction. Total RNA was extracted using TRIzol reagent (Invitrogen, Cat. No.15596026). The cDNA was synthesized from total RNA using PrimeScript Reverse Transcriptase (Takara, Cat. No. DRR063A). Real-time PCR was accomplished with the ABI Prism 7500 analyzer (Applied Biosystems, Carlsbad, CA) using SYBR Premix Ex TaqTM (Takara, Cat. No. DRR041A).

MBP Ac1–9[4K] and rhIL-2 at a final concentration of 10 μg/mL and 20 U/mL, respectively,

were added to the cell suspension, and cultures were incubated in 6-well plates at 37°C and 5% CO2 humidified atmosphere. After at least 5 days, the cultured splenocytes were washed and CD4+ T cells were isolated by positive selection. FK228 ic50 5×104in vitro expanded CD4+ T cells from peptide-treated Tg4 mice were co-cultured with an equal number of untreated CD4+ T cells, or at ratios from 1:1 to 1:32 of peptide-treated to untreated CD4+ T cells, at 100 μg/mL of MBP Ac1–9[4K] in the presence of 1×105 APC/mL. After 72 h, wells were pulsed with 0.5 μCi [3H] thymidine overnight and the incorporated radioactivity was

measured on a liquid scintillation β-counter (1450 Microbeta; Wallac). check details Staining for intracellular cytokine expression was performed using BD CytoFix/CytoPerm Plus Kit (BD Biosciences). Splenocytes from peptide-treated mice were collected 2 h after the last treatment and restimulated with PMA and ionomycin (Sigma-Aldrich) at a final concentration of 5 ng/mL and 500 ng/mL of culture, respectively, for 4 h in the presence of GolgiStop (BD Biosciences). After the incubation, cells were stained with anti-Vβ8 FITC (BD Biosciences), fixed, permeabilized and stained intracellularly with anti-IL-2 APC, anti-IL-4 PE, anti-IL-10 APC, anti-IL-17 PE and anti-IFN-γ PE antibodies, or Ig isotype controls (BD Biosciences). Fluorescence intensity was measured on a FACSCalibur or BD™ LSR II flow cytometer (BD Biosciences) and analyzed using FlowJo software (Tree Star). Conventional sandwich ELISA was carried out according to instructions from the manufacturer using paired antibodies to assay the quantity of IL-2, IL-10 and IFN-γ (BD Biosciences) in cell culture supernatants. Optical densities

were measured at 450/595 nm on a SpectraMax 190 microplate reader and the amount of cytokine present quantified with standard curves using SoftMax Pro software (both from Molecular Amylase Devices). Statistical analyses were performed where stated using GraphPad Prism (GraphPad Software) software. The statistical significance of differences between data groups was determined by an unpaired t-test. A p value of ≤0.05 was considered to be significant. We thank Drs. C.A. Sabatos-Peyton and J. Verhagen for critical reading of this manuscript. We also thank Miss L.E.L. Falk and ASU staff for assistance with the breeding of mice. This work was supported by the Wellcome Trust and the MS Society of Great Britain and Northern Ireland. Conflict of interest: The authors declare no financial or commercial conflict of interest. Detailed facts of importance to specialist readers are published as ”Supporting Information”. Such documents are peer-reviewed, but not copy-edited or typeset. They are made available as submitted by the authors.

If the excessive anticoagulation occurs, an infusion of fresh-frozen plasma and packed red blood cells may be required to reverse the effects of the interaction. Although CYP2C9 is a minor pathway for voriconazole biotransformation, it significantly inhibits S-warfarin. The interaction between voriconazole and warfarin increases the INR by 41%, and the effects buy Ensartinib can persist for approximately 1 week after voriconazole discontinuation.134 This interaction

occurs independently of the homozygous PM phenotype.134 There are no published data describing an interaction between posaconazole and warfarin. Interactions involving azoles and phenytoin.  Certain azoles can interact with phenytoin in a bidirectional manner, whereby the azole first inhibits the CYP-mediated

metabolism, and then phenytoin subsequently induces the CYP-mediated PXD101 metabolism of the azole. Data from healthy volunteers demonstrate that fluconazole significantly increased the AUC0–24 and Cmin of phenytoin.135 Although the study demonstrated that phenytoin did not affect fluconazole pharmacokinetics, in practice, induction will likely occur. That study used healthy volunteers and thus the dose and duration of phenytoin were minimised for ethical and safety reasons.135 The bidirectional nature of the azole–phenytoin interaction is best illustrated with voriconazole. Phenytoin 300 mg once daily co-administration with oral voriconazole 400 mg twice daily for 10 days produced increased steady-state phenytoin Cmax and AUCτ values by approximately 70% and 80% respectively.136 However, when multiple doses of phenytoin (300 mg once daily) were administered with voriconazole 200 mg twice daily for 2 weeks, steady-state voriconazole plasma Cmax and systemic AUCτ were significantly reduced to approximately 50% and 30%, respectively, for up to 12 h postdose.136 Although doubling the voriconazole dose from 200 to 400 mg twice daily compensates for the effect of phenytoin,

it subsequently leads to the inhibition of CYP-mediated metabolism of second phenytoin,136 One parallel-designed interaction study demonstrated that posaconazole co-administration produced modest increases in steady state phenytoin Cmax (24%) and systemic AUC (25%), which were not considered clinically significantly.137 However, this study used healthy volunteers, included a small sample size, the volunteers did not serve as their own controls, and substandard doses of posaconazole (200 mg day−1) and phenytoin (200 mg day−1) were employed. Whether these limitations impacted the magnitude of the observed interaction remains unclear. Transport proteins are important contributors to drug disposition. Itraconazole, posaconazole and caspofungin are substrates and/or inhibitors of several transport proteins including P-gp and the OATPs.

Furthermore, MG-132 chemical structure both TREG cells and T effector (TEFF) cells from Lgals3−/− mice showed higher expression of Notch1 and the Notch target gene Hes-1. Interestingly, Notch signaling components were also altered in both TREG and TEFF cells from uninfected Lgals3−/− mice. Thus, endogenous galectin-3 regulates the frequency and function of CD4+CD25+Foxp3+ TREG cells and alters the course of

L. major infection. Galectins are a family of glycan-binding proteins composed of 15 members that are conserved throughout animal evolution and share sequence similarities in their carbohydrate-recognition domain [1-3]. Galectin-3, a widely distributed member of the family, plays pleiotropic roles in innate and adaptive immunity by regulating cytokine production, phagocytosis, chemotaxis, signaling, and

survival [4-7]. Through these mechanisms, galectin-3 has been proposed to control host immunity against several infectious agents [1, 6-8]. Yet, despite considerable evidence on the role of galectin-3 in the control of immune responses, its contribution to T regulatory (TREG) cell function during microbial attack has not yet been explored. TREG cells, either inducible or naturally occurring, suppress effector T (TEFF)-cell responses through different mechanisms including cell–cell contact and secretion of immunosuppressive cytokines such as IL-10, TGF-β, and/or IL-35 [9]. Interestingly, galectin-1 and -10 have been proposed to mediate the immunosuppressive activity of Foxp3+ TREG cells [10, 11] and galectin-3 has been postulated as a potential marker for human TREG cells [12]. In addition, NVP-AUY922 datasheet galectin-3 Methane monooxygenase increases the severity of autoimmune neuro-inflammation by decreasing the frequency of TREG cells [13], suggesting that this lectin might also influence the TREG cell

compartment during microbial infection. We took advantage of the availability of galectin-3-deficient (Lgals3−/−) mice on a BALB/c background in order to investigate the function of TREG cells during the course of Leishmania major infection. This experimental model has provided extensive information on the factors that regulate the development of CD4+ T helper (Th) cells in vivo [14] and has contributed to dissect the role of TREG cells during intracellular infections [15-18]. Here, we show that Lgals3−/− mice display higher frequency of TREG cells both in draining lymph nodes (LNs) and infection sites during L. major infection. Moreover, Lgals3−/− TREG cells produce higher amounts of IL-10, have enhanced suppressive capacity, and show altered Notch expression compared with wild-type (WT) mice. Thus, endogenous galectin-3 influences TREG cell number and function during parasitic protozoa infection. To investigate the role of galectin-3 within the TREG cell compartment, we first compared the outcome of L. major infection in Lgals3−/− and WT mice on BALB/c background.

5a). These results showed that the presence of MyD88 is not essential

for the signalling initiated by zymosan. While the deletion of MyD88 was partial in these animals, they showed reduced neutrophil recruitment to LPS, confirming the role of the TLR4–MyD88 pathway in detecting LPS and also validating that the deletion was sufficient to impair responses (Fig. 5b). In contrast, tamoxifen treatment of wild-type mice did not impair responses (data not shown). On the other hand, when cKO mice when Adriamycin treated with tamoxifen from Day 0 of birth, these mice exhibited reduced neutrophil recruitment to zymosan as compared with untreated mice (Fig. 5c). These results supported our hypothesis selleck compound that for inflammatory ligands like zymosan, MyD88 is required during the pre-challenge phase for activation of immune cells but is dispensable during the actual inflammatory

challenge. One of the major findings of this study is that for neutrophil-mediated acute inflammation to several pro-inflammatory agents, the immune system needs to be previously stimulated by intestinal flora in a MyD88-dependent fashion. This stimulation enables the host to mount a neutrophil response to future inflammatory insults. We have shown that germ-free and flora-deficient mice are defective in neutrophil migration to a number of different microbial and sterile inflammatory ligands. This defect can be corrected by supplementing the drinking water with LPS, a TLR4–MyD88 agonist, before challenge with the inflammatory agent. Furthermore, pre-treatment of flora-deficient MyD88 knockout mice with LPS failed to restore neutrophilic infiltration, showing that LPS specifically acts through MyD88 to prime the immune system. Presumably other PAMPs that stimulate MyD88–TLRs would have similar effects, Verteporfin nmr although this has not yet been tested. There is some evidence that PAMPs derived

from intestinal flora are present systemically in the mammalian body under physiological conditions.[29, 30] These ligands presumably translocate into the circulation via the intestinal epithelium. In a similar fashion, we hypothesize that ligands derived from gut flora, such as LPS (TLR4–MyD88), bacterial DNA (TLR9–MyD88), peptidoglycan (TLR2–MyD88) as well as others, activate MyD88 signalling that then enables systemic neutrophilic inflammatory responses. A previous report published by our laboratory had shown that MyD88 knockout mice do not show a defect in zymosan-induced neutrophil migration.[31] The basis for this discrepancy is unclear. It is possible that this difference was the result of the extent of backcrossing of the MyD88-deficient mice; the mice in the present study were fully backcrossed onto the B6 background whereas those in the earlier study were not.

The primers used in the quantification of the mRNAs are Daporinad listed in Table 2. Constitutive gyrB transcription was used as an internal standard for RNA concentration. The transcript level of experimental genes was calculated relative to gyrB transcripts.

The relative transcriptional level of experimental genes in the S. epidermidis wild-type (WT) strain was set to 1, and the level in the other strains was calculated proportionally. Data are from three independent experiments. Immuno-dot blot assays were performed as described in our previous work (Xu et al., 2006). Western blot was performed as described previously (Pamp et al., 2006) and modified as follows: S. epidermidis strains were grown in B-medium. selleck chemical At an OD600 nm of 0.5, cells were harvested. Cell pellets were resuspended in 50 mM Tris-HCl (pH 8.0) and lysed by the addition of 25 μg mL−1 lysostaphin (Sigma) and incubation at 37 °C for 60 min. Cell debris was removed by centrifugation. The protein concentration was determined using a BCA protein Assay kit (Keygen Biotech Co.). Twenty micrograms of each sample was separated on 15% sodium dodecyl sulfate-polyacrylamide gels, and then transferred onto a Protran-BA83 nitrocellulose membrane (Whatman). Spx was probed with a 1 : 1500 dilution of the Spx antibody (a generous gift from P. Zuber), a 1 : 1000 dilution of HRP-Goat anti-Rabbit IgG (Proteintech) and the

ECL Advance Western Blotting Detection Kit Amisulpride (GE Healthcare Life Sciences). To determine whether S. epidermidis has the spx gene, we examined the available S. epidermidis genome information (Gill et al., 2005) and identified a candidate ORF whose predicted protein product was 80% identical and 95% similar to the B. subtilis Spx protein, as well as a conserved N-terminal CXXC motif. Staphylococcus epidermidis Spx is very similar to S. aureus Spx (identity at the amino acid level of 98%) (Gill et al., 2005). According to the fact that both the upstream and the downstream genes of S. epidermidis spx are

transcribed in a direction opposite to that of spx, spx is probably an independent ORF with its own promoter. In B. subtilis, it was demonstrated that Spx is a substrate of ClpP protease from in vitro proteolysis experiments (Nakano et al., 2002, 2003b). In S. aureus, Spx accumulates remarkably in the absence of ClpP, strongly indicating that ClpP protease degrades Spx in S. aureus (Pamp et al., 2006). To investigate whether ClpP protease degrades Spx in S. epidermidis, we examined the expression level of Spx in the S. epidermidis clpP mutant strain by Western blot. A much higher Spx level was found in the clpP mutant strain (Fig. 1). Spx accumulates with the absence of ClpP protease, indicating that Spx may also be a substrate of ClpP protease in S. epidermidis, similar to B. subtilis and S. aureus. To investigate the role of Spx in the biofilm formation of S.

S1). Apparently, strains of these three spoligotypes formed a monophyletic cluster (Fig. S1) and, at the same time, they grouped closely and together with ST34 (see the cluster marked with * in Fig. S1; spoligoprofiles are shown in Fig. 2). It should be noted that ST34 is a prototype of the S family (Brudey et al., 2006). ST125 and related spoligotypes ST4 and ST1280 were classified as LAM/S in the SITVIT2 database, based on the previously GS1101 described decision rules (Filliol et al., 2002), because the absence of spacers 21–24 and 33–36 is specific for the LAM family, whereas the absence of spacers 9–10 and 33–36 is specific for the S family. Application of the recently

proposed approach to define the LAM family based on LAM-specific IS6110 insertion (Marais et al., 2006) demonstrated the absence of this insertion in the studied strains of ST125, ST4 and ST1280 as well as ST34. It appears that spoligotypes ST125, ST4 and ST1280, in Bulgaria, definitely do not belong to the LAM family

and may indeed belong to the S family. ST125 strains formed a well-delimited cluster in the UPGMA tree of the Bulgarian strains (Fig. S1), likely the youngest compared with other more distant clusters and related types ST4 and ST34, as manifested by null or very short branches in the NJ tree (not shown). One strain of type ST4 had the same 21-locus profile as the majority of ST125 strains that may have been ancestral VNTR-haplotype T1 within the ST125 spoligotype. Considering the single-spacer difference between ST125 and 3-deazaneplanocin A cell line ST4, it is not unlikely that spoligoprofile ST125 originated from ST4 by a single spacer deletion (spacer #40) (Fig. 2). Additionally, Avelestat (AZD9668) this observation suggests the ancestral position of the MIRU-type T1. However, we should also keep in mind that ST4 was shown to have two potential ancestors in South Africa, LAM3 (ST33) or S (ST34) (Warren et al., 2002). Because we did not study the presence or absence

of the LAM-specific IS6110 insertion in other ST125 strains in SITVIT2, we cannot formally exclude that the evolution of some ST125 genotypes, for example in Africa, may stem from the LAM3 progenitor. In order to understand the pattern of evolution and dissemination of ST125 in Bulgaria, we performed 21-VNTR typing of the available ST125 strains, which subdivided them into 12 subtypes [T1–T12 (Figs 2 and 3)]. A tree shown in Fig. 3 is the most parsimonious network. It is remarkable how well it corroborates with a recent hypothesis about a mode of evolution of the VNTR loci in M. tuberculosis, mainly via loss than gain of mainly single rather than multiple repeats (Grant et al., 2008). Indeed, a closer look at Fig. 3 reveals that all changes present a reduction of the copy number in a locus, and 17 of 21 changes are single unit loss.

Conclusion  There appears to be very little regulation of TLR2 and TLR4 at the mRNA level during normal pregnancy and labor. However, now that the normal values of TLR expression on maternal neutrophils have been determined it will be possible to compare them to those from pregnancies complicated by such conditions as preeclampsia, preterm labor, or preterm premature rupture of membranes. “
“Prions are a unique group of pathogens, which are considered to comprise solely of an abnormally folded isoform of the cellular prion protein.

The accumulation and replication of prions within secondary lymphoid organs is important for their efficient spread from the periphery to the brain where they ultimately cause neurodegeneration and death. Mononuclear phagocytes (MNP) play key roles in prion disease pathogenesis. AP24534 mouse Some MNP appear to facilitate the propagation of prions to and within lymphoid tissues, whereas others may aid their clearance by phagocytosis PD0332991 mw and by destroying them. Our recent data show that an intact splenic marginal zone is important for the efficient delivery of prions into the B-cell follicles where they subsequently replicate upon follicular dendritic cells before infecting the nervous system. Sialoadhesin is an MNP-restricted cell adhesion molecule that binds sialylated glycoproteins. Sialoadhesin is constitutively expressed upon splenic marginal zone metallophilic and lymph

node sub-capsular sinus macrophage populations, where it may function to bind sialylated glycoproteins, pathogens and exosomes in the blood and lymph via recognition of terminal sialic acid residues. As the prion glycoprotein is highly sialylated, we tested the

hypothesis that sialoadhesin may influence prion disease pathogenesis. We show that after peripheral exposure, prion pathogenesis was unaltered in sialoadhesin-deficient mice; revealing that lymphoid sequestration of prions is not mediated via sialoadhesin. Hence, although an intact marginal zone is important for the efficient uptake and delivery of prions into the B-cell follicles of the spleen, this is not influenced by sialoadhesin expression by the MNP within it. “
“Inflammation Tryptophan synthase and genital infections promote the increase in leukocytes, pro-inflammatory cytokines, and oxygen reactive species, impairing sperm functions such as motility, capacitation, and acrosome reaction. All these functions are primarily regulated by cytoplasmic concentration of Ca2+ ([Ca2+]cyto). This study evaluated the effect of tumor necrosis factor (TNF)-α on the [Ca2+]cyto and its regulation in human sperm. Sperm loaded with fura-2 were incubated with or without TNF-α (0–500 pg/mL) from 0 to 120 min. After incubation, the basal [Ca2+]cyto and membrane permeability to Ca2+ were evaluated by spectrofluorometry, before and after Ca2+ addition to the extracellular medium.

The association of MCL and FcεRI-γ is surprising given that MCL lacks the canonical motif — a positively charged amino acid in the transmembrane

domain — for binding activating adaptors, and others have tried and failed to demonstrate this association [4]. The Thr38 residue of MCL that they postulate mediates the association with FcεRI-γ is conserved in the rat, but we have been unable to demonstrate any direct association of rat MCL to FcεRI-γ. The direct recognition of TDM that Miyake et al. [13] describe suggests that MCL can play a role in TDM recognition independently of its association with Mincle. In our hands, rat MCL reporters are not stimulated by mycobacteria, while Mincle reporters are stimulated by mycobacteria (Supporting Selleckchem RG-7204 Information Fig. 1). Although it is unknown ABT 263 exactly how TDM is recognized by Mincle, both TDM and the Malassezia ligand for Mincle [21] are glycolipids. Although the presence of both the saccharide and lipid portions of TDM is important for recognition by Mincle [10], it is likely that the sugar moiety is the major antigen determinant. Sugar recognition is mediated by the lectin domain, and within this domain,

a tripeptide motif is thought to heavily influence the type of sugar moieties that can be recognized. An EPX motif (where X is usually asparagine) mediates binding to glucose moieties such as found in TDM [22]. The EPN tripeptide motif is conserved in Mincle from rat, mouse, and human, and Mincle from all three species is able to mediate recognition of Malassezia and mycobacterial cord factor ([8, 10, 11] and our unpublished data). For MCL, the EPX motif is conserved in rat and human (although X is D in human and K in rat), but in mouse only the E is conserved. This suggests that there is little selection pressure on this motif in MCL or that different ligands are recognized by the different species. In addition, MCL has previously been shown to have very weak sugar binding [23]. One possible explanation for the differences we

see is that MCL binds rather to the lipid Molecular motor portion. Although lipid binding by C-type lectins is unusual, it is not unheard of — surfactant proteins A and D are both able to bind to a range of lipids via their carbohydrate recognition domains [24]. In their experimental system with purified TDM, the lipid portion is presumably exposed and available for binding to MCL reporter lines; in our system with intact mycobacteria, the lipid portion may be buried in the membrane and thus unable to stimulate our MCL reporters. If this hypothesis is correct, the Mincle/MCL heterodimer described here could allow co-ordinate binding to the TDM molecule, with Mincle binding to the sugar moiety and MCL to the lipid. The congenic rat strains DA.APLEC (APLEC gene complex from PVG) [25] and DA.NKCB (NK complex from PVG) [26] were maintained under conventional conditions.