pneumoniae population screened Reference int gene int_for GCGTGATTGTATCTCACT 1046 Tn916 Dual-positive, erm(B)-positive, mef(E)-positive [29]   int_rev GACGCTCCTGTTGCTTCT       [29] xis gene xis_for AAGCAGACTGAGATTCCTA 193 Tn916 Dual-positive, erm(B)-positive, mef(E)-positive [29]   xis rev GCGTCCAATGTATCTATAA  

    [29] tnpRgene O21 CCAAGGAGCTAAAGAGGTCCC C188-9 chemical structure 1528 Tn917 Dual-positive, erm(B)-positive, mef(E)-positive [29]   O22 GTCCCGAGTCCCATGGAAGC       [29] tnpA gene O23 GCTTCCATGGGACTCGGGAC 2115 Tn917 Dual-positive, erm(B)-positive, mef(E)-positive [29]   O24 GCTCCCAATTAATAGGAGA       [29] Spans insert of erm(B) elements in Tn916 J12d ATTCCCATTGAAGACGCAGAAGT 800 Tn3872 erm(B)-positive that are Tn916-positive [34]   J11d CTACCGCACTTCGTTTGGTGTAC 3600 Tn6002   [34]       7900 Tn6003 or Tn1545     Junction of mega insert and Tn916 SG1 CTCACTGCACCAGAGGTGTA 1000 Tn2009 or Tn2010 Dual-positive

and mef(E)-positivie that are Tn916-positive [30]   LTf GCAGAGTATACCATTCACATCGAAGTTCCAC       30] Junction of erm(B) element and Tn916 EB2 AGTAATGGTACTTAAATTGTTTAC 3300 Tn2010 Dual-positive that are Tn916-positive [31]   TN2a GAAGTA(G/C)AAGCTAAAGATGG I-BET-762       [32] a Modified from original to change melt temperature or incorporate degeneracies Results KU55933 concentration macrolide resistance In our collection of 592 S. pneumoniae isolates, 140 (23.6%) are erythromycin resistant, including only 5 of the 104 invasive isolates. Within the erythromycin resistant population, at least 110 (78.6%) are multidrug resistant, defined here as resistant to antibiotics in at least 3 different classes or 2 classes and positive for the tet(M) gene if not tested for tetracycline susceptibility. Of the 140 erythromycin resistant strains, 44 (31.4%) were mef(E)-positive including three invasive isolates, 13 (9.3%) were erm(B)-positive including one invasive isolate, and 73 (52.1%) were dual mef(E)/erm(B)-positive

including one invasive isolate. One isolate was positive for mef(A). Nine (6.4%) were negative for the macrolide resistance genes and no further analyses were conducted pheromone to determine their resistance mechanisms. Thirty-eight of the mef(E)-positive isolates expressed the M-phenotype while six expressed the MLSB phenotype, manifesting alternative clindamycin resistance mechanisms. All 13 erm(B)-positive isolates showed MLSB. Sixty-eight of the dual-positive isolates showed MLSB; the remaining five expressed the M-phenotype suggesting clindamycin resistance is inducible or erm(B) is non-functional in these isolates. Ten of the 452 erythromycin susceptible isolates were mef(E)-positive, one was erm(B)-positive, and five were dual-positive, signifying a loss of gene function in these isolates. Time series Macrolide resistance rates in our collection increased from 1999 to 2004, then stabilized through 2008 (Table 2). Table 2 Time series of macrolide resistance gene presence, sequence types, and serotypes in S.