6 at 37°C. Protein expression was induced by the addition of 0.02% arabinose. E. coli cultures were further incubated for 2 h at 37°C. His-tagged proteins

were purified by nickel affinity chromatography (Qiagen, Hombrechtikon, Switzerland) as previously S3I-201 supplier described [9, 10]. The purification of 2 liter culture yielded a total of 1 mg recombinant protein. Purity of protein was estimated as 90%. Non-induced cultures were prepared accordingly as controls for immunoblots and enzyme activity assays. Enzyme activity assay Protein content was determined by the method of Bradford (BioRad, Reinach, Switzerland) using bovine serum albumin as a standard. The recombinant M. suis sPPase activity was assayed as described by Saheki and coworkers [35] using a reaction mixture containing 5 mM Mg2+, 100 mM Tris, pH 7.5 and 1 mM PPi (Na4P2O7) at 55°C in a final volume of 200 μl. Reactions were started by adding 10 μL diluted M. suis rPPase (100 ng) and stopped by adding 1 ml 200 mM Glycin/HCl, pH 3.0. Then, 125 μl of 1% ammonium molybdate (in 25 mM H2SO4) and 125 μl of 1% ascorbic

acid (in 0.05% KHSO4) were added to JQ1 ic50 the mixtures and incubated for 30 min at 37°C. Yeast sPPase (Sigma, Buchs, Switzerland) was used as positive control. Preparations derived from non-induced pBad-ppa (purified accordingly to recombinant PPase) were used as selleck chemical Negative controls. To determine the Mg2+ and pH dependency individual assay components were varied. Activity was also measured using 5 mM Mn2+, Zn2+ instead of Mg2+ cations. For inhibition assays 5 mM Ca2+ and EDTA, respectively, were added to the reaction mixture. The amount of Pi liberated from the hydrolysis of PPi was measured using a spectrophotometer (Shimadzu 160-UV-A) and a standard Pi curve. The PPase activity was defined as μmol Pi min-1 mg-1 protein. Preparation of an anti-PPase rabbit immune serum A rabbit immune serum was prepared as previously described

[10] using 0.4 mg recombinant PPase for each immunization. Immunizations were conducted under the registration number 156/2002 with the legal prescriptions. SDS PAGE and immunoblots SDS PAGE and immunoblots were performed according to standard from protocols. The M. suis cells were prepared from the blood of experimentally infected pigs as previously described [32]. Negative controls were accordingly prepared from the blood of M. suis-negative pigs. PCR and sequencing PCR amplification of the ppa gene was performed using the primers: ppa_for: ATGTCAAAAAATAATATAGTGGA; ppa_rev TTAATAATTTGATTGTTATTCTCC, and the HotStarTaq Polymerase Master Mix (Qiagen). PCR conditions were: 15 min at 95°C for activation of Taq polymerase, 30 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min. Amplified fragments were purified using the Qiaquick PCR Purification Kit (Qiagen) and sequenced (Medigenomix). The ppa sequence was deposited in the EMBL Nucleotide Sequence Database under accession number FN394679. References 1.