5 hours). Addition of 1 ml H2O and subsequent
thorough shaking resulted in the separation of two phases. The upper phase (methanol, H2O and H2SO4) was discarded. The lower phase (containing the 3-hydroxyacyl methylesters) was selleck dried over Na2SO4 and analyzed by GC. One unit is defined as 1 μmol R-3-hydroxyoctanoic acid production per minute. Values presented here are averages of two determinations. Expression and purification of PhaC1 from P. putida U for preparation of anti-PhaC1 antibodies Purification of PhaC1 was achieved by using N-terminal His6-tag fusions. Two degenerate primers (BamH1 5′ GTGGATCCGTAACAAGAACAACGATGAGCTGCAGCGGC 3′ and XbaI 5′ CTGTCTAGAAAAAAGTCCCGTGGCGCTC 3′) were used to amplify phaC1 from P. putida U. The amplified gene was cloned into pKB-2, digested with BamH1/SacI and cloned into the commercial vector pQE-32 (Qiagen). After
overexpression of phaC1 in E. coli XL-Blue, PhaC1 was purified by metal chelate affinity chromatography (Qiagen). Antibodies against purified PhaC1 were prepared as previously described [40]. Acknowledgements We wish to thank Prof. Luengo (University of Leon, Spain) and Dr. H. E. Valentin (Monsanto, U.S.A.) for their generous gifts of P. putida mutants. This work was supported by grants from the Swiss Federal Office from Education and Science (BBW no. 96.0348) to G.d.R. and Q.R. Dabrafenib clinical trial References 1. Anderson AJ, Dawes EA: Occurrence, metabolism, metabolic role, and industrial uses of bacterial polyhydroxyalkanoates. Microbiol Rev 1990, 54:450–472.PubMed 2. Witholt B, Kessler B: Perspectives of medium-chain length poly(hydroxyalkanoates), a versatile set of bacterial bioplastics. Curr Opinion Biotech 1999, 10:279–285.CrossRef 3. de Koning GJM, Kellerhals MB, van Meurs C, Witholt B: Poly(hydroxyalkanoates) from fluorescent pseudomonads in retrospect and prospect. J Env Polymer Deg 1996,4(4):243–252.CrossRef 4. de Roo G, Kellerhals MB,
Ren Q, Witholt B, Kessler B: Production of chiral R -3-hydroxyalkanoic acids and R -3-hydroxy alkanoic acid methylesters via hydrolytic degradation of polyhydroxyalkanoate synthesized by pseudomonads. Biotech Bioeng 2002,77(6):717–722.CrossRef why 5. Ren Q, Grubelnik A, Hoerler M, Ruth K, Hartmann R, Felber H, Zinn M: Bacterial poly(hydroxyalkanoates) as a source of chiral hydroxyalkanoic acids. Biomacromolecules 2005,6(4):2290–2298.PubMedCrossRef 6. Ruth K, Grubelnik A, Hartmann R, Egli T, Zinn M, Ren Q: Efficient production of ( R )-3-hydroxycarboxylic acids by biotechnological conversion of polyhydroxyalkanoates and their purification. Biomacromolecules 2007,8(1):279–286.PubMedCrossRef 7. Pötter M, Steinbüchel A: Poly(3-hydroxybutyrate) granule-associated proteins: Impacts on poly(3-hydroxybutyrate) synthesis and degradation. Biomacromolecules 2005,6(2):552–560.PubMedCrossRef 8.