3) were constructed LBH589 manufacturer by PCR-based amplification and subcloned into the pcDNA3 eukaryotic expression vector (Invitrogen, Carlsbad, CA, USA). The primers were as followed: Klf10-pcDNA3: GAATTCGCAGCCAGGCAGCTCGCGAC, GCGGCCGCTCACTGTGCGGAAGCAGGGGT Klf11-pcDNA3: GAATTCCTCCTGCCTCGCAGCATTGCT,
GCGGCCGCTCAGCCAGAGGCCGGCAAGG Bone marrow cells were isolated from the tibia and femur and cultured in RPMI 1640 medium with 10% FBS (Hyclone, UT, USA), 2 mM glutamine, 100 units/mL penicillin-streptomycin, 10 ng/mL M-CSF (PeproTech, NJ, USA), or 20 ng/mL murine selleck chemicals GM-CSF (R&D systems, MN, USA) at 37°C with 5% CO2 for 5 days to harvest M-BMMs or GM-BMMs, respectively. HEK293 cells were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in DMEM supplemented with 2 mM glutamine, 100 units/mL penicillin and streptomycin, and 10% FBS at 37°C in the presence of 5% CO2.
Transient transfection into primary mouse bone marrow derived macrophage using Amaxa Mouse Macrophage Nucleofection kit (Cat. No. VPA-1009) was performed according to manufacturer’s instruction. Transient transfection into HEK293 cells was performed by Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instruction. To knock down Klf11 in M-BMMs from WT or klf10-deficient mouse, the ON-TARGET plus SMART Cyclin-dependent kinase 3 pool mouse-TIEG3 (194655) or the negative control siRNA (Thermo Scientific Dharmacon, Lafayette, CO, USA) were transfected into M-BMMs using INTERFERinTM (Polyplus, Graffenstaden, France) according to the manufacturer’s instruction. Another siRNA
against Klf11 (5′- UGCAUGUGGACCUUUCGCUGUCAUG-3′) and control siRNA were synthesized by Shanghai GenePharma Co., Ltd. and were transfected using INTERFERinTM (Polyplus, Graffenstaden, France) according to the manufacturer’s instruction. Total RNA was extracted using TRIzol reagent (Invitrogen, Cat. No.15596026). The cDNA was synthesized from total RNA using PrimeScript Reverse Transcriptase (Takara, Cat. No. DRR063A). Real-time PCR was accomplished with the ABI Prism 7500 analyzer (Applied Biosystems, Carlsbad, CA) using SYBR Premix Ex TaqTM (Takara, Cat. No. DRR041A).